Why is mapper.pl from mirdeep2 producing an empty mapping file?

1

Hello All,

I am new to mirna analysis and using mirdeep2 for alignment and quantification of miRNA. The miRNA was developed using the true kit from Illumina. I've used the mapper.pl program to perform adapter removed using command1. I made the index to the reference using bowtie_v_1.2 using command2. Now, I am trying to create a mapping file using mapper.pl, the script runs successfully but the mapping file is empty [command3]. Can you please provide comments as to where my I am making a mistake? Appreciate all your help.

Thanks

command1: mapper.pl ../RawData.fq -e -h -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -s reads_collapsed.fa

command2: bowtie-build genome/GRCh38.p13.genome.fa.gz  GRCh38.p13

command3: mapper.pl reads_collapsed.fa -c -p GRCh38.p13 -t reads_collapsed_vs_genome.arf


mirna


ngs


next-gen

• 238 views

updated 2 hours ago by

0

written 3 months ago by

▴

250



Source link