gravatar for harry

2 hours ago by

>ENST00000014935
TAGGTTTTTAATTACCTTTATTTTATTTTGCCAAACATACCTGGGAATACCTTTTATTTTTTTTTTACCTTGGGGTGATGGTTCCAAACCATAAATGTGATTATAGTTAACACATGACCCTTCTAGCGTCCCAGCCAGTGTTTTTCCTGACCTCTCTTCTTTGGAGAGGAGGATGGAAGGGAGGGGTCCGGCATGCTGCTGGCATTTTGCTGTGTCCTGCAGCCCCTTTCCGGGACACCTGGGTTCACACAGCTTTTTAGCTTACATAACTGGTGCAGATTTTCTGTGTGGAGATGTTGCCTTGACCAGCCTTGGCTGGACTTTACCAGGCATGCAGAAGCCTGTACCAACACAGACTACAGCACCCAGGAGGTGCGAGTGTGGCTGCTCAGCGGTTATAACAGGCCTGACTGCATTGTTCACCGGATTATAATGAGCCAAAATGTTTCCCGGTGTTTGCTGGTTTCAGGGAAGGAGTTTGATATAGCAGATTAACCACCCTCCTTGTAGCTATTGGGGCTTAATGGTTTCCTGGTGATTCTTACCAATCCACAATAAACATGGCCCATTGGCATATCTGCTGCACAAGTGTCCTATCTCACCAATCTGGGTTTTTGTTCTCAGTAACTTTCCTTCTTGTCATACAACATCTTCATTCCTCTTTCTGAACCCTCCCTTCCCCTACCCCAACCCAGAGCCCACTTTGTCTCCACTCCTGATACTACACTACCTGGCAGGTGGCATGAGTGCAGGGCCCCTGGCTTCCTCTCCTAATCTAGGCACAAGCCCAACCAAAGAACAAGAGCCAAATCAAACAAGGCAGGCAGGGGTGGACTACAGTCACAGGGCAACTATAGTTGAAGCCCCCCAGCCCCAGGGCTGGATGGACGGGGGAGGCTGGGGTTTAAGTCCCAAAAGGCAGCAGGCCCTGGGGGGGTAGGGGGACGCTCAGGCAGCAGGGCACAGCTGAGGGGACAGGAGTGATAGCAGCAACAGAACAGTGAGGCTGAGAGGCTGGACGCTGTGCGCCTGGCTCAGCTTCAGCTCCACCTCCACGGGGTAGTGGTCACTGATGTTGAGGGC
>ENST00000014944
TCCTCCTCGGTGAGCTGGAAGCTCGTGGGGAAGTCAAAGGCAGCCGCAGTGTGCAGCAGACTCCGGCAGCGCTCCCCGTGCAGCACGACGCGGTCATAGGTGCAGTGGGTGCTGGCCCGCACTGTGGTGTCCTCCCCATCGGCAATCACCCAGTGGAAGCCTGGCTCAGTCCGCAGCTCCAGCTTGTCCAGGCGCTTTTTGGTCAGTGAAGCGCAGTCAGCATTGAAGTCCCCAAGCAGGATCACGTC

Likewise, I have a huge fasta sequence and I want to reverse the sequence of those fasta sequences like below:-

>ENST00000014935
CGGGAGTTGTAGTCACTGGTGATGGGGCACCTCCACCTCGACTTCGACTCGGTCCGCGTGTCGCAGGTCGGAGAGTCGGAGTGACAAGACAACGACGATAGTGAGGACAGGGGAGTCGACACGGGACGACGGACTCGCAGGGGGATGGGGGGGTCCCGGACGACGGAAAACCCTGAATTTGGGGTCGGAGGGGGCAGGTAGGTCGGGACCCCGACCCCCCGAAGTTGATATCAACGGGACACTGACATCAGGTGGGGACGGACGGAACAAACTAAACCGAGAACAAGAAACCAACCCGAACACGGATCTAATCCTCTCCTTCGGTCCCCGGGACGTGAGTACGGTGGACGGTCCATCACATCATAGTCCTCACCTCTGTTTCACCCGAGACCCAACCCCATCCCCTTCCCTCCCAAGTCTTTCTCCTTACTTCTACAACATACTGTTCTTCCTTTCAATGACTCTTGTTTTTGGGTCTAACCACTCTATCCTGTGAACACGTCGTCTATACGGTTACCCGGTACAAATAACACCTAACCATTCTTAGTGGTCCTTTGGTAATTCGGGGTTATCGATGTTCCTCCCACCAATTAGACGATATAGTTTGAGGAAGGGACTTTGGTCGTTTGTGGCCCTTTGTAAAACCGAGTAATATTAGGCCACTTGTTACGTCAGTCCGGACAATATTGGCGACTCGTCGGTGTGAGCGTGGAGGACCCACGACATCAGACACAACCATGTCCGAAGACGTACGGACCATTTCAGGTCGGTTCCGACCAGTTCCGTTGTAGAGGTGTGTCTTTTAGACGTGGTCAATACATTCGATTTTTCGACACACTTGGGTCCACAGGGCCTTTCCCCGACGTCCTGTGTCGTTTTACGGTCGTCGTACGGCCTGGGGAGGGAAGGTAGGAGGAGAGGTTTCTTCTCTCCAGTCCTTTTTGTGACCGACCCTGCGATCTTCCCAGTACACAATTGATATTAGTGTAAATACCAAACCTTGGTAGTGGGGTTCCATTTTTTTTTTATTTTCCATAAGGGTCCATACAAACCGTTTTATTTTATTTCCATTAATTTTTGGAT
>ENST00000014944
CTGCACTAGGACGAACCCCTGAAGTTACGACTGACGCGAAGTGACTGGTTTTTCGCGGACCTGTTCGACCTCGACGCCTGACTCGGTCCGAAGGTGACCCACTAACGGCTACCCCTCCTGTGGTGTCACGCCCGGTCGTGGGTGACGTGGATACTGGCGCAGCACGACGTGCCCCTCGCGACGGCCTCAGACGACGTGTGACGCCGACGGAAACTGAAGGGGTGCTCGAAGGTCGAGTGGCTCCTCCT

Can anyone tell me how can I do this. Thanks in advance.

link

written
2 hours ago
by

harry10



Source link