gravatar for willnotburn

2 hours ago by

United States, Michigan State Universtiy

I am trying to trim adapters from raw Novaseq sequences. Here is the FastQC from raw seqs:

Raw sequences checked by FastQC. Reverse only is shown.

Raw sequences checked by FastQC. Reverse only is shown.

Problems

I need to trim adapters. Does the rest of the report offer any clues as to what's wrong with the run? Is it overall bad?

Sequencing facility told me the following

Platform: TrueSeq

Kit: Swift Accel-NGS 2s DNA library prep kit

Adapters

I used AdapterRemoval with two approaches (neither worked well)

  • Used facility-supplied adapters inserting NNNNNN hexamer for the spacers

    AdapterRemoval --threads 40 --file1 sample_R1.fastq.gz --file2 sample_R2.fastq.gz --adapter1 AATGATACGGCGACCACCGAGATCTACACNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT --adapter2 CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

    After trimming using facility-supplied P5 and P7. Reverse only is shown.

    After trimming using facility-supplied P5 and P7. Reverse only is shown.

  • Used identify_adapters in AdapterRemoval, which gave me P5 that partially matched what the facility said (above) but totally different P7 sequences. Using the automatically detected adapters, I also tried trimming as follows.

    AdapterRemoval --threads 40 --file1 sample_R1.fastq.gz --file2 sample_R2.fastq.gz --adapter1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG --adapter2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

    After trimming using automatically-deleted adapters. Reverse only is shown.

    After trimming using automatically detected adapters. Reverse only is shown.

What am I doing wrong? What should I be doing?



Source link