gravatar for Daier

2 hours ago by

Hi,
We performed 10x genome-wide re sequencing of bird blood samples. When extracting mitochondrial genes, we found that there were a lot of N in the gene sequence. Some sequences are as follows:

acaagcaatccacgctcttaccctaacaatccttctaggattctacttcacaggcctcca
aggcatagaatactacgaagcaccattctccatcgcagatagcgtctacggctctacctt
ctttgtcgcNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNttacataactatcta
ctgatgaggatcatactcttctagtatattcattacaatcgacttccaatccttaaaatc
tggtttaaccccagagaagagtaatgaacataattacattcataattaccctatccctaa
ccttaagcctcatcctaaccgcactgaacttctgaatcgcccaaatgaaccccgatgcag
aaaaactatccccctNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNccaccaccacactcacctgagcat
 ccatcctaatcctcctcctcactctgggactagtatacgaatgaatccaaggaggactag
 aatgagcagaataaaaaggcaagaaagttagtctaattaagacagttgatttcggctcaa
 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNcaataatccttgcccaaccatccatcctcctagccttctcagcctc
agaacttacacacttttacatggcatttgaagccactctaatccctaccctaattctcat
cctactactaaaactcggaggctatggcattatacgattcacaaccctagtaaacccaac
attaaacaaccttcactacccattcatcaccttagccctatgaggagcactaataaccag
cgccatctgcttacgacaaatcgacctaaaatNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  NNNNNgcctagtcatcgctgcaaccataatccagacccaatgagcattctcaggagcaat

This kind of sequence can not be compared on megax software, unless the N in the sequence is deleted, but it takes time to open one sample to delete a large number of N, so is there any command or script that can quickly delete n in each sample sequence? Thank you!

link

written
2 hours ago
by

Daier0



Source link