gravatar for sara.behrozi7

2 hours ago by

does STRT-seq protocol has any barcode file?

AATGATACGGCGACCACCGATNNNNNNGGGXX..XXCTGTCTCTTATACACATCTGACGCXXXXXXXXTCGTATGCCGTCTTCTGCTTG
i.e (21bp of Sequence) + (6bp UMI) + (Variable bp of Sequence again) + "GACGC" + (8bp Cell Barcode) + (Variable bp of Sequence again)

this is my barcode format, how should I write barcode pattern for UMI tool extract?



Source link