Split the sequence into each SNP entry

0

Hi,

I have a file from SNP data and would like to add

  1. from each sequence split the sequence into two with each SNP entry - this is bit tricky to do
  2. Add fasta symbol before each sequence start then. I know how to do this one using shell - sed 's/^([^acgt])/>1/'.

     AAGGGTTTAGAAAAAAACCAAACAAACAATCGAAA[C/T]GAAATAGAAAAAGAAAAAGGGAAGGGGTTAAGTTC
     TTCATATAAAAATTGATATAGAATCTTTGAAAAAG[A/C]CCTTTCTTCCTAAGAAAGAAAAGGCTTACTGTCTT
     CCCAAATAAACAGGTATGGAAGCTATAATTGGAAA[C/T]CACGATCGAATTTATGGAAGCATTGGTTTATACAT
     GGATCCAAAAGAAACTTGGGCATTTATTACTTGGA[C/T]GATATTCGGGATTTATTTACATACTCGAACAAATA
     TATCAGTTAGTCTACCATATTTTTTTCTTGACAGA[A/C]AACTAAGGAAATGGCTCCATGTGCTCTAATTCATT
     ACTAACTCTAAAGTAAAGGATCTTTCCACCTTTTC[G/T]GATCCCATACCAATAGCTTTTTTTGATTCGTCCAT
     AGTTTACACACTTTTGTATTACCTCTTCTTACTGC[C/T]GTATTTATGTTAATGCATTTCCTAATGATACGTAA
     AATAGATCTGACAAGTCGCACTATATGTCAACCCA[A/C]GATGGATGCTTGTCCCCGGGACTTCGATAAGGTAC
    

Thank you


sequence


snp

• 43 views



Source link