gravatar for harry

3 hours ago by

Hi everyone,
I have an exon.fasta file which looks like ---

>ENSE00002234944
TTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGC
TGGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATCTTCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGA
GTGAGAGCATCAACTTCTCTCACAACCTAGGCCA
>ENSE00001746346
CAGGGCCATCAGGCACCAAAGGGATTCTGCCAGCATAGTGCTCCTGGACCAGTGATACACCCGGCACCCTGTCCTGGACACGCTGTTGGCCTGGATCTGAGCCCTGGTGGAGGTCAAAGCCACCTTTGGTTCTGCCATTGCTGCTGTGTGGAA
>ENSE00002312635
CAGGGCCATCAGGCACCAAAGGGATTCTGCCAGCATAGTGCTCCTGGACCAGTGATACACCCGGCACCCTGTCCTGGACACGCTGTTGGCCTGGATCTGAGCCCTGGTGGAGGTCAAAGCCACCTTTGGTTCTGCCATTGCTGCTGTGTGGAAGTTCACTCC
TGCCTTTTCCTTTCCCTAGAGCCTCCACCACCCCGAGATCACATTTCTCACTGCCTTTTGTCTGCCCAGTTTCACCAGAAGTAGGCCTCTTCCTGACAGGCAGCTGCACCACTGCCTGGCGCTGTGCCCTTCCTTTGCTCTGCCCGCTGGAGACGGTGTTTG
TCATGGGCCTGGTCTGCAGGGATCCTGCTACAAAGGTGAAACCCAGGAGAGTGTGGAGTCCAGAGTGTTGCCAGGACCCAGGCACAGGCATTAGTGCCCGTTGGAGAAAACAGGGGAATCCCGAAGAAATGGTGGGTCCTGGCCATCCGTGAGATCTTCCCA
GGGCAGCTCCCCTCTGTGGAATCCAATCTGTCTTCCATCCTGCGTGGCCGAGGGCCAGGCTTCTCACTGGGCCTCTGCAGGAGGCTGCCATTTGTCCTGCCCACCTTCTTAGAAGCGAGACGGAGCAGACCCATCTGCTACTGCCCTTTCTATAATAACTAA
AGTTAGCTGCCCTGGACTATTCACCCCCTAGTCTCAATTTAAGAAGATCCCCATGGCCACAGGGCCCCTGCCTGGGGGCTTGTCACCTCCCCCACCTTCTTCCTGAGTCATTCCTGCAGCCTTGCTCCCTAACCTGCCCCACAGCCTTGCCTGGATTTCTAT
CTCCCTGGCTTGGTGCCAGTTCCTCCAAGTCGATGGCACCTCCCTCCCTCTCAACCACTTGAGCAAACTCCAAGACATCTTCTACCCCAACACCAGCAATTGTGCCAAGGGCCATTAGGCTCTCAGCATGACTATTTTTAGAGACCCCGTGTCTGTCACTGA
AACCTTTTTTGTGGGAGACTATTCCTCCCATCTGCAACAGCTGCCCCTGCTGACTGCCCTTCTCTCCTCCCTCTCATCCCAGAGAAACAGGTCAGCTGGGAGCTTCTGCCCCCACTGCCTAGGGACCAACAGGGGCAGGAGGCAGTCACTGACCCCGAGACG
TTTGCATCCTGCACAGCTAGAGATCCTTTATTAAAAGCACACTGTTGGTTTCTG

I want to cut each exon in 2 half and join the 2nd half upstream to the 1st half. So can anyone tell me how to do it?
See the example below like this:
1-This is the origional exon

>ENSE00002234944
TTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGC
TGGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATCTTCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGA
GTGAGAGCATCAACTTCTCTCACAACCTAGGCCA

2-I just divide the exon in 2 half then attach the 2nd half upstream to the 1st half then it looks like this:

CCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATCTTCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGAGAGCATCAACTTCTCTCACAACCTAGGCCA
TTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCTGG

3-So i want create new fasta file like above for whole exon.fasta file in single command. So can you please tell me how to do it. Thanks in advance.

link

modified 2 hours ago

by

finswimmer14k

written
3 hours ago
by

harry10



Source link