gravatar for zhao03

3 hours ago by

hello,
when i run gatk, the error always occur, like this "java.lang.IllegalArgumentException: samples cannot be empty"
is there mistake in my input file?
thank you for your help !

my bam file as following:
HWI-EAS418:3:37:1070:1462 83 chr20 46689301 255 50M = 46687222 -2129 CAGCTCCAGGCCGCTCAAGAAGCGGCTGCTCCGCTCCCGGGCTGCGGCCA 0:@2%,6.=:.4=,4+6;B79>=BB=2>7=:9=4([email protected]>BB??A NH:i:1 HI:i:1 AS:i:99 nM:i:0

the script is following:
java -jar /home/H/mutation/gatk/gatk-package-4.1.4.1-local.jar HaplotypeCaller -R /home/H/mutation/ref/ctat_genome_lib_build_dir/ref_genome.fa
-I /home/H/mutation/ctat-mutations-master/testing/__misc_data/Aligned.sortedByCoord.out.GRCh38.bam
--recover-dangling-heads true
--dont-use-soft-clipped-bases
-stand-call-conf 20.0 -O test.vcf

the logs are followinig:
Runtime.totalMemory()=2260729856
java.lang.IllegalArgumentException: samples cannot be empty
at org.broadinstitute.hellbender.utils.Utils.validateArg(Utils.java:725)
at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.ReferenceConfidenceModel.<init>(ReferenceConfidenceModel.java:116)
at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCallerEngine.initialize(HaplotypeCallerEngine.java:221)
at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCallerEngine.<init>(HaplotypeCallerEngine.java:164)
at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCaller.onTraversalStart(HaplotypeCaller.java:224)
at org.broadinstitute.hellbender.engine.GATKTool.doWork(GATKTool.java:1046)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.runTool(CommandLineProgram.java:139)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMainPostParseArgs(CommandLineProgram.java:191)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:210)
at org.broadinstitute.hellbender.Main.runCommandLineProgram(Main.java:163)
at org.broadinstitute.hellbender.Main.mainEntry(Main.java:206)
at org.broadinstitute.hellbender.Main.main(Main.java:292)

link

modified 3 hours ago

written
3 hours ago
by

zhao0330



Source link