I am doing some tests to learn more about SAM flags.

In an attempt to split an original BAM file into two forward and reverse BAM files following this tutorial I bumped into a question. I am using paired end data.

A00681:387:HCVJTDRXY:1:2245:2419:34898 99 chr3 85295832 255 139M = 85295832 139 ACGAGTTAGTGGGTGCAACACACCAGCATGGCACATGTATACATATGTAACTAACCTGCACAATGTGCACAAGTACCCTAAAACTTAAAGTATAATAAAAAAAAGAAAAAAAGAAGAAGAAAAAAAAAGTAGTAAACCT FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:F:FFF:F:::FFFFFF:F,FFF,F:FFFFFF:,FFFF:F,FF NH:i:1 HI:i:1 AS:i:274 nM:i:1 NM:i:0 MD:Z:139 jM:B:c,-1 jI:B:i,-1 rB:B:i,1,139,85295832,85295970 MC:Z:139M

A00681:387:HCVJTDRXY:1:2245:2419:34898 147 chr3 85295832 255 139M = 85295832 -139 ACGAGTTAGTGGGTGCAACACACCAGCATGGCACATGTATACATATGTAACTAACCTGCACAATGTGCACAAGTACCCTAAAACTTAAAGTATAATAAAAAAAAGAAAAAAAGAAGAAGAAAAAAAAAGTACTAAACCT FFF,FFFFFFFFF:FFFFF::,,FFF,FF,F,F,F:FFFFFFFFFFFFFFFFFFFF,FF:FFFF:F:,FFFF,:FFF:FFFFFF:FFFF,:FFFFFFF,FFFFF:FFFFFFFFFF,,FFFFFFFFFFFFFF,FFF,FFF NH:i:1 HI:i:1 AS:i:274 nM:i:1 NM:i:1 MD:Z:131G7 jM:B:c,-1 jI:B:i,-1 rB:B:i,141,279,85295832,85295970 MC:Z:139M

They have the same QNAME. Different flags:

Maybe I have not understand correctly the meaning of QNAME, but are these the same read?? If so why do they have different flags and 1 nucleotide of a difference (in bold)??

From the SAM format manual:
"Reads/segments having identical QNAME are regarded to come from
the same template."
What exactly they mean by template?

In my quest to understand this, I ran featureCounts two times one with -s 2 (it's a reversely stranded library) and -s 0. -s 0 gives me double counts.
I am not sure how to interpret this... Any help?



Source link