gravatar for harry

2 hours ago by

>exon18_ENST00000194900|exon19_ENST00000194900
GCTATCAAGAGACTGCAGCAAGCACAACTTTACCCCATTGCCATTTTCATCAAGCCCAAGTCCATTGAAGCCCTTATTACTACCCGGCCTCGACGTGATAATGAGGTGGATGGACAAGACTACCACTTTGTGGTGTCCCGAGAACAAATG
>exon18_ENST00000194900|exon21_ENST00000194900
TCTAACAGAGGAAGAACTGTATTATCAAACCTTATGGTCTACCCATGAATAAATAAAATATTTGTTCAAGCACAAATACTACCCGGCCTCGACGTGATAATGAGGTGGATGGACAAGACTACCACTTTGTGGTGTCCCGAGAACAAATGG
>exon18_ENST00000194900|exon20_ENST00000194900
CAGACATATGAACAAGCAAATAAGATCTATGACAAAGCCATGAAACTGGAGCAGGAATTTGGAGAGTACTTTACAGTACTACCCGGCCTCGACGTGATAATGAGGTGGATGGACAAGACTACCACTTTGTGGTGTCCCGAGAACAAATGG
>exon18_ENST00000194900|exon21_ENST00000194900
CTCTAACAGAGGAAGAACTGTATTATCAAACCTTATGGTCTACCCATGAATAAATAAAATATTTGTTCAAGCACAAATACTACCCGGCCTCGACGTGATAATGAGGTGGATGGACAAGACTACCACTTTGTGGTGTCCCGAGAACAAATG
>exon17_ENST00000194900|>exon17_ENST00000194900
ATGATGACCTGATCTCCGAATTTCCACATAAATTTGGATCCTGTGTGCCACTCACTATGCAAGGCCTGTGATCATCCTGGGCCCAATGAAGGACCGAGTCA
>exon19_ENST00000194900|exon21_ENST00000194900
TCTAACAGAGGAAGAACTGTATTATCAAACCTTATGGTCTACCCATGAATAAATAAAATATTTGTTCAAGCACAAAGCAAGCACTGCATCTTAGATGTTTCCGGCAATGCTATCAAGAGACTGCAGCAAGCACAACTTTACCCCATTGCC
>exon19_ENST00000194900|exon20_ENST00000194900
CAGACATATGAACAAGCAAATAAGATCTATGACAAAGCCATGAAACTGGAGCAGGAATTTGGAGAGTACTTTACAGGCAAGCACTGCATCTTAGATGTTTCCGGCAATGCTATCAAGAGACTGCAGCAAGCACAACTTTACCCCATTGCC
>exon19_ENST00000194900|exon21_ENST00000194900
CTCTAACAGAGGAAGAACTGTATTATCAAACCTTATGGTCTACCCATGAATAAATAAAATATTTGTTCAAGCACAAAGCAAGCACTGCATCTTAGATGTTTCCGGCAATGCTATCAAGAGACTGCAGCAAGCACAACTTTACCCCATTGC

In this example of fasta sequence, you see there is some repeat of fasta sequence many times.for example- exon19_ENST00000194900|exon21_ENST00000194900 , exon18_ENST00000194900|exon21_ENST00000194900
So I want to remove all fasta sequence which has the same header in the fasta file and keep only 1 fasta sequnece. I want to remove fasta sequence on the basis of header not the sequence.
Thanks in advance

link

written
2 hours ago
by

harry10



Source link