gravatar for a.puwanat

4 hours ago by

Hello everyone,

I am using an R package, ShortRead, to read a fasta file. The look of the info in the fasta file is like the following:

>[email protected]|ORF_ID: 403|ORF_SIZE:159|TEMPLATE_ACCESSION: BC009508.2, BC010491.1|GENE_ID: 112597|PERFECT_MATCH
ATGACAGACACCGAAAATCACGACTCAGCCCCCTCCAGCACCTCTACCTGTTGCCCGCCGATCACAGCCGGAATGCAGCTGAAAGATTCCCTGGGGCCTGGTTCCAACCGCCCACTGTGGACTCTGAGGCCTCTGCATTTGCGGGTGGTCTGCCTGA

>[email protected]|ORF_ID: 228|ORF_SIZE:135|TEMPLATE_ACCESSION: BC016025.1|GENE_ID: 9168|PERFECT_MATCH
ATGGCAGACAAACCAGACATGGGGGAAATCGCCAGCTTCGATAAGGCCAAGCTGAAGAAAACGGAGACGCAGGAAAAGAACACCCTGCCGACCAAAGAGACCATTGAGCAGGAGAAGCGGAGTGAAATTTCCTAA

I used to be able to execute a ShortRead function, readFasta, to read the fasta file, but when I just came back to use it again, it gave me an error saying,

Error: Subscript contains out-of-bounds indices

Could anyone help me with this ? I am an R beginner, and I could not troubleshoot this problem. Thank you so much for your help !



Source link