gravatar for stambukf

3 hours ago by

Hi everyone.

I want to order a fasta file where i have 35000 sequences with different length in nucleotides.
But i don't know how to do it.

Examples:

>contig_1
AAATCGAAACTAGACCATAGC
>contig_2
AAAAAACGTACAGAC
>contig_3
TTTTCGACAAACGAAAACGATTAGCCCAGAC

i want to ordering like this (from shorter to larger length):

>contig_1
AAAAAACGTACAGAC
>contig_2
AAATCGAAACTAGACCATAGC
>contig_3
TTTTCGACAAACGAAAACGATTAGCCCAGAC

I already red another post how to rearrange fasta file according to its length and there is a script but i think that is bad because doesn't run when a ran it.

Please help.

link

modified 3 hours ago

by

genomax80k

written
3 hours ago
by

stambukf10



Source link