gravatar for Pierre Lindenbaum

2 hours ago by

France/Nantes/Institut du Thorax - INSERM UMR1087

I have tried with efetch but as I do not have sudo right on the server to install it.

if you have wget, you can use the NCBI efetch service.

$ wget -q -O - "https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&id=NG_049243.1&rettype=fasta"
>NG_049243.1 Acinetobacter baumannii C1AC9-24 blaKPC gene for carbapenem-hydrolyzing class A beta-lactamase KPC-10, complete CDS
ATGTCACTGTATCGCCGTCTAGTTCTGCTGTCTTGTCTCTCATGGCCGCTGGCTGGCTTTTCTGCCACCG
CGCTGACCAACCTCGTCGCGGAACCATTCGCTAAACTCGAACAGGACTTTGGCGGCTCCATCGGTGTGTA
CGCGATGGATACCGGCTCAGGCGCAACTGTAAGTTACCGCGCTGAGGAGCGCTTCCCACTGTGCAGCTCA
TTCAAGGGCTTTCTTGCTGCCGCTGTGCTGGCTCGCAGCCAGCAGCAGGCCGGCTTGCTGGACACACCCA
(...)



Source link