I have 2 paired end RNA-Seq data and i need to find miRNAs therefore i am using miRDeep2. I installed the miRDeep2 through conda (could not make manual installation). First i am making my index through bowtie by

bowtie-build GCA_018258275.1_ASM1825827v1_genomic.fna index_file

Then i am starting the mapper.pl by

mapper.pl SRR1687231_1.fastq -e -h -i -j -k AGATCGGAAGAG -l 21 -m -p index_file -s R_collapsed.fa -t R_refdb.arf -v -o 4

But i consistently getting this result

parsing fastq to fasta format
converting rna to dna alphabet
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
trimming unmapped nts in the 3' ends
Log file for this run is in mapper_logs and called mapper.log_8642
Mapping statistics

total: 0 0 0 Illegal division by zero at /home/bane/anaconda3/bin/mapper.pl line 737.

This is my mapper.log

current dir: /home/bane/Desktop/Mine_1200TL/miRdeep2
mapper command: /home/bane/anaconda3/bin/mapper.pl 31_1.fastq -e -h -i -j -k GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC -l 21 -m -p index -s R_collapsed.fa -t R_refdb.arf -v -o 4

timestamp: 16_07_2021_t_21_16_08

parsing fastq to fasta format
fastq2fasta.pl 31_1.fastq > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads.fa
converting rna to dna alphabet
rna2dna.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads.fa > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_dna.fa
discarding sequences with non-canonical letters
fastaparse.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_dna.fa -b > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_letters.fa 2>dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_discarded.fa
clipping 3' adapters
clip_adapters.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_letters.fa GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_clip.fa
discarding short reads
fastaparse.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_clip.fa -a 21 > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_no_short.fa 2>dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_too_short
collapsing reads
collapse_reads_md.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_no_short.fa seq > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_nr.fa
mapping reads to genome index
bowtie -p 4 -f -n 0 -e 80 -l 18 -a -m 5 --best --strata index --al dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/31_1.fastq_mapped --un dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/31_1.fastq_not_mapped dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_nr.fa dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.bwt 2>bowtie.log

convert_bowtie_output.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.bwt > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.arf
trimming unmapped nts in the 3' ends
parse_mappings.pl dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.arf -j > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings_trim.arf

remove tmp dir


I can not figure out the problem. Can anyone help me with this problem?
By the way this is my first attempt of miRNA

Source link