gravatar for kuntalasb

3 hours ago by

Hello, I downloaded LncTar package from www.cuilab.cn/. I want to analyse RNA-RNA interaction. For this, I formatted my two input RNA fasta files according to the manual and examples provided with the LncTar package i.e.,

 >RNAid1
 Sequence in one line
 >RNAid2
 Sequence in one line

But, when I try running the command:

perl LncTar.pl -p 1 -l RNAfile1 -m RNAfile2 -d -0.1 -s T -o output.txt

I get the following error:

the format of file is error, Please check! The name and the sequence do not put in a row!

I have checked my input file multiple times, it is formatted according to the software's requirement. For your reference, both of my input files look like this:

>Cre00001921    
ATGGCTCCTGGTATAGGAAGCTAATATCTTTCCTTTTTAAGGTGGGGCTAGTTCAAAG
>Cre00000880    
GAATGACGCAAGCTCCTCTCTTCAATAAAGattttgaaCACAAATAATGGAATAAATCG

but I am clueless regarding this error. Can anyone help me in resolving this? Any assistance would be greatly appreciated. Thank you.

link

modified 28 minutes ago

written
3 hours ago
by

kuntalasb10



Source link