gravatar for blur

2 hours ago by

European Union

I aligned and created bam files for an experiment, and when I open a gene I see reads.
But, then I ran HTSEq counts on the same file and the counts = 0

The cmd was:

htseq-count -n 6 file.bam mouse.gtf > htseq_counts_results

Why am I getting zero?
Any help would be appreciated

EDIT - more info:
The reference file looks like this (with chr)
chr1 havana gene 3143476 3144545 . + . gene_id "ENSMUSG00000102693"; gene_version "2"; gene_name "4933401J01Rik"; gene_source "havana"; gene_biotype "TEC";
chr1 havana transcript 3143476 3144545 . + . gene_id "ENSMUSG00000102693"; gene_version "2"; transcript_id "ENSMUST00000193812"; transcript_version "2"; gene_name "4933401J01Rik"; gene_source "havana"; gene_biotype "TEC"; transcript_name "4933401J01Rik-201"; transcript_source "havana"; transcript_biotype "TEC"; tag "basic"; transcript_support_level "NA (assigned to previous version 1)";

Alignment files look like this:
NB 16 chr12 31318525 60 110M33S * 0 0 AGACCGTGGACTCTGTAGAGAAGAAAGTCAATGAGATAAAAGACATCCTGGCCCAGAGCCCAGCAGCGGAACCACTGAAAAACATTGGCATTCTCTTCGAGGAGGCAGAGAAACTAACCAAAGATGTCACAGAAAAGATGACA AAEA<<a&lt;<eaeee<eaaaaaeeee<ae<eaeaeaeeee ee="" eeeeeeea="" eeaeeaeeeeeeeee<aeee="" eeeeaeeeaeeeeae<="" eeeeeeeeeeeee<eeeeeeeeeeeeeaeeeeeeeeeeeeaeeeeeaeeeea="" nm:i:0="" md:z:110="" as:i:110="" xs:i:19="" sa:z:chr12,31319919,-,109s31m3s,60,0;<="" p="">

link

modified 35 minutes ago

written
2 hours ago
by

blur180



Source link