gravatar for luckysardar171

2 hours ago by

Hello every one I have paired end illumina reads for chip-seq analysis. Fastqc report adapter content and all so per sequence GC content not passing, I tried trimmomatic but still i am getting same result. can anyone suggest me how can I resolve this problem

command I tried

trimmomatic PE read1.fastq.gz read2.fastq.gz filt_read1.fastq.gz read2.fastq.gz ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 HEADCROP:20

after this still did not pass the adapter content and per sequence GC content

TruSeq3-PE.fa file contains collected from different biostar threads

Illumina_Universal_Adapter (copied from FastQC data files)

AGATCGGAAGAG

TruSeq_Universal_Adapter

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

TruSeq_Universal_Adapter_RC

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

TruSeq_Index_Adapter

GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

TruSeq_Index_Adapter_RC

CAAGCAGAAGACGGCATACGAGAT

Can any one suggest me how can I resolve this Thank you

result image

drive.google.com/file/d/15SC0r31eJFDYs9Rowysxd4853iO1XQBW/view?usp=sharing, drive.google.com/file/d/1msoloMqHHBfCTuAyAqPXxJYyomZBeVdX/view?usp=sharing

Thank you



Source link