gravatar for  DataFanatic

2 hours ago by

Hi,
I have fastq files which are all R1 but I want to be sure that they are single-end sequencing ( in case R2 was misplaced for example)
I'm unsure if for single-end the 1 from this code 1:N:0:GGAGAA represents one of a pair??
Here is what R1 file looks like:

+
AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE<EEEEEEEEEEEEAEEE
@NS500449:529:HYW33BGX5:1:11101:12403:1046 1:N:0:GGAGAA
CGGAANTTTACGTTCGCTGTGTTTGTGTACGACACAAAGTTTGTGCCAAGTTTTTTAAATCAATTACATTTTTGA


+
AAAAA#6AEE/EEEEEEEEE6EEEEEEEEAEEAEEEEEEEA<<E/AEEAEA/EEAEE//EEEEEEEAAEEEE<E<
@NS500449:529:HYW33BGX5:1:11101:8275:1047 1:N:0:GGAGAA
CGAAGNCCTTGGTTCAAAAGGTTCTGGAGTTCGTGGATGAGCATGGAACCGAGGTGCTTAACCTGGGCAGCTTCA


+
AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEAEEEEEAE
@NS500449:529:HYW33BGX5:1:11101:19612:1048 1:N:0:GGAGAA
GCAGCNGGCAATAATCTTAATGCCCATGGAATTACTCCGGATAAAGATCTGCCAAAGTCCACGGCAATGCCCAGCA

Thanks for your time!



Source link