gravatar for p

9 hours ago by

I have list of genes like

LOC109802912

LOC109788332

LOC109789928

LOC109809764
...

and have a fasta file like

>rna-XR_003803819.1 gene=LOC114915746
TGCTTCTTCTCTGTTGGAAGAGTTTAAAAGCAATAAAACTAAGTGTTTTGAGCTCTCTGAAATTGCTGGT
CATGTTGTTGAGTTCAGTGCGGATCAATATGGGAGCCGATTTATTCAGCAAAAGCTTGAAACAGCTActa
ca

>rna-XR_002239520.2 gene=LOC109794983
TCCTATTCATCATGCAGGATGTCAGAATCTTCATTTCAAATTGGACCAATCCTTCTTGTGAATGAACCCT
TCACGATTGATAATGGTCTAATGACACCTACTTTGAAAATTCGAAGAGATAGAGTTGTGGCTCAATACAG
G

how can i get the fasta sequences for genes?

link

modified 6 hours ago

by

genomax83k

written
9 hours ago
by

p0



Source link