gravatar for chiara.conte91

2 hours ago by

Hello everybody!
I have to filter out some sequences from a fast file
fasta is like

>0 RH1_6550
CAGCAGCCGCGGTAATACATAAACTCAAAGGAATTGACGGGCAGCAGCCGCGGTAATACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGACATTTAAGTCAGGGGTGAAATCCCAGAGCTCAACTCTGGAACTGCCTTTGATACTGGGTGTCTTGAGTGTGAGAGAGGTATGTGGAACTCCGAGTGTAGAGGTGAAATTCGTAGATATTCGGAAGAACACCAGTGGCGAAGGCGACATACTGGCTCATTACTGACGCTGAGGCGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGATTGCTAGTTGTCGGGCTGCATGCAGTTCGGTGACGCAGCTAACGCATTAAGCAATCCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGGAATTGACGG
>1 LH1_2535
CAGCAGCCGCGGTAATAGCAGCCGCGGTAATACGGAGGGTCCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTGTTAAGCCAGATGTGAAATCCCCGGGCTCAACCTGGGAATTGCATTTGGAACTGGCGAACTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCATGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTCGGAGTTTGGTGTCTTGAACACTGGGCTCTCAAGCTAACGCATTAAGTAGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAAGGAATTGACG
>10 LPI1_10041
CAGCAGCCGCGGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGCGTACGTAGGCGGATCAGAAAGTAGGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTCCTAAACTCCTGGTCTTGAGTTCGAGAGAGGTGAGTGGAATTCCAAGTGTAGAGGTGAAATTCGTAGATATTTGGAGGAACACCAGTGGCGAAGGCGGCTCACTGGCTCGATACTGACGCTGAGGTACGAAAGTGTGGGGAGCAAACAGGATTAGATACCCCGGTAGTCCACACCGTAAACGATGAATGCCAGTCGTCGGGCAGTATACTGTTCGGTGACACACCTAACGGATTAAGCATTCCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGGAATTGACGG
>100 RH3_70592
CAGCAGCCGCGGTAATACGGGGGGTGCGAGCGTTATTCGGAATTACTGGGCGTAAAGAGCGCGTAGGCGGTCTCTTAAGTCAGGTGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCACTTGAAACTAAGAGACTTGAGTATGGGAGAGGGAAGTGGAATTCCTGGTGTAGCGGTGAAATGCGTAGATATCAGGAGGAACATCAGTGGCGAAGGCGACTTCCTGGACCAATACTGACGCTGAGGCGCGAAGGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCAGTAAACGGTGAACACTAGGTGTAGCGGGTATTGACCCCTGCTGTGCCGCAGCAAACGCATTAAGTGTTCCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAAGGAATTGACGG
>1000 SHI1_76884
CAGCAGCCGCGGTAATACAGAGGTCCCGAGCGTTGTTCGGATTCACTGGGCGTAAAGGGAGCGTAGGCGGTCGGCAAAGTCTGATGTGAAATCTCCGGGCCCAACCCGGAAACTGCATCGGATACTGGTCGGCTAGAGGATTGGAGGGGGGACTGGAATTCTCGGTGTAGCAGTGAAATGCGTAGATATCGAGAGGAACACCAGTGGCGAAGGCGAGTCCCTGGACAATTCCTGACGCTGAGGCACGAAAGCTAGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCTAGCCGTAAATGGTGCACGCTTGCTGTGGGCGGAATCGACCCCGTCCGTGGCGTAGCTAACGCGTTAAGCGTGCCGCCTGGGGAGTACGACCGCAAGGTTGAAACTCAAAGGAATTGACGG

and I have a list of IDs to exclude (the number 0,10,100) or the entire identifier >0 RH1_6550.

I tried to use qiime1
filter_fasta.py -f inseqs.fasta -o list_filtered_seqs.fasta -s seqs_to_keep.txt
but it returned empty fasta file.

Any clue of how to do it?

Thanks in advance!!
Best,
Chiara



Source link