How to create a dummy GFF file from fasta?

I want to identify if the 3' region of genes have higher coverage in some samples compared to others. The way I thought of doing this was to map to the genes and then convert to bed to calculate the coverage for specific regions via bedtools coverage.

bedtools coverage [OPTIONS] -a <bed/gff/vcf> -b <bed/gff/vcf> so I need to get a gff file. Is there a tool or easy method that I can use to create a dummy GFF so I can run this tool? If there is a better method to do this please let me know.

My fasta file looks like this:

>EG11277
ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGA
>EG10998
ATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCAGGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAACGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATTGTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGTCAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCCCCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCTCAAGCACCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACCGGTCAAGGGCATTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCTGGTCCGGGGATGAAAGGGATGGTCGGCATGGCGGCGCGCGTCTTTGCAGCGATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGAATACAGCATCAGTTTCTGCGTTCCACAAAGCGACTGTGTGCGAGCTGAACGGGCAATGCAGGAAGAGTTCTACCTGGAACTGAAAGAAGGCTTACTGGAGCCGCTGGCAGTGACGGAACGGCTGGCCATTATCTCGGTGGTAGGTGATGGTATGCGCACCTTGCGTGGGATCTCGGCGAAATTCTTTGCCGCACTGGCCCGCGCCAATATCAACATTGTCGCCATTGCTCAGGGATCTTCTGAACGCTCAATCTCTGTCGTGGTAAATAACGATGATGCGACCACTGGCGTGCGCGTTACTCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTGGCGTCGGTGGCGTTGGCGGTGCGCTGCTGGAGCAACTGAAGCGTCAGCAAAGCTGGCTGAAGAATAAACATATCGACTTACGTGTCTGCGGTGTTGCCAACTCGAAGGCTCTGCTCACCAATGTACATGGCCTTAATCTGGAAAACTGGCAGGAAGAACTGGCGCAAGCCAAAGAGCCGTTTAATCTCGGGCGCTTAATTCGCCTCGTGAAAGAATATCATCTGCTGAACCCGGTCATTGTTGACTGCACTTCCAGCCAGGCAGTGGCGGATCAATATGCCGACTTCCTGCGCGAAGGTTTCCACGTTGTCACGCCGAACAAAAAGGCCAACACCTCGTCGATGGATTACTACCATCAGTTGCGTTATGCGGCGGAAAAATCGCGGCGTAAATTCCTCTATGACACCAACGTTGGGGCTGGATTACCGGTTATTGAGAACCTGCAAAATCTGCTCAATGCAGGTGATGAATTGATGAAGTTCTCCGGCATTCTTTCTGGTTCGCTTTCTTATATCTTCGGCAAGTTAGACGAAGGCATGAGTTTCTCCGAGGCGACCACGCTGGCGCGGGAAATGGGTTATACCGAACCGGACCCGCGAGATGATCTTTCTGGTATGGATGTGGCGCGTAAACTATTGATTCTCGCTCGTGAAACGGGACGTGAACTGGAGCTGGCGGATATTGAAATTGAACCTGTGCTGCCCGCAGAGTTTAACGCCGAGGGTGATGTTGCCGCTTTTATGGCGAATCTGTCACAACTCGACGATCTCTTTGCCGCGCGCGTGGCGAAGGCCCGTGATGAAGGAAAAGTTTTGCGCTATGTTGGCAATATTGATGAAGATGGCGTCTGCCGCGTGAAGATTGCCGAAGTGGATGGTAATGATCCGCTGTTCAAAGTGAAAAATGGCGAAAACGCCCTGGCCTTCTATAGCCACTATTATCAGCCGCTGCCGTTGGTACTGCGCGGATATGGTGCGGGCAATGACGTTACAGCTGCCGGTGTCTTTGCTGATCTGCTACGTACCCTCTCATGGAAGTTAGGAGTCTGA
>EG10999
ATGGTTAAAGTTTATGCCCCGGCTTCCAGTGCCAATATGAGCGTCGGGTTTGATGTGCTCGGGGCGGCGGTGACACCTGTTGATGGTGCATTGCTCGGAGATGTAGTCACGGTTGAGGCGGCAGAGACATTCAGTCTCAACAACCTCGGACGCTTTGCCGATAAGCTGCCGTCAGAACCACGGGAAAATATCGTTTATCAGTGCTGGGAGCGTTTTTGCCAGGAACTGGGTAAGCAAATTCCAGTGGCGATGACCCTGGAAAAGAATATGCCGATCGGTTCGGGCTTAGGCTCCAGTGCCTGTTCGGTGGTCGCGGCGCTGATGGCGATGAATGAACACTGCGGCAAGCCGCTTAATGACACTCGTTTGCTGGCTTTGATGGGCGAGCTGGAAGGCCGTATCTCCGGCAGCATTCATTACGACAACGTGGCACCGTGTTTTCTCGGTGGTATGCAGTTGATGATCGAAGAAAACGACATCATCAGCCAGCAAGTGCCAGGGTTTGATGAGTGGCTGTGGGTGCTGGCGTATCCGGGGATTAAAGTCTCGACGGCAGAAGCCAGGGCTATTTTACCGGCGCAGTATCGCCGCCAGGATTGCATTGCGCACGGGCGACATCTGGCAGGCTTCATTCACGCCTGCTATTCCCGTCAGCCTGAGCTTGCCGCGAAGCTGATGAAAGATGTTATCGCTGAACCCTACCGTGAACGGTTACTGCCAGGCTTCCGGCAGGCGCGGCAGGCGGTCGCGGAAATCGGCGCGGTAGCGAGCGGTATCTCCGGCTCCGGCCCGACCTTGTTCGCTCTGTGTGACAAGCCGGAAACCGCCCAGCGCGTTGCCGACTGGTTGGGTAAGAACTACCTGCAAAATCAGGAAGGTTTTGTTCATATTTGCCGGCTGGATACGGCGGGCGCACGAGTACTGGAAAACTAA


fasta


coverage


bed


gff

• 44 views



Source link