gravatar for yueli7

2 hours ago by

China

Hello,

I have data: SRR3196086_1.fastq, SRR3196086_2.fastq.

www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE133466

Sequencing was performed on llumina NextSeq 550 machine using a HighOutput flowcell in paired-end mode (R1: 26 cycles; I1: 8 cycles; R2: 57 cycles)

How many bp of barcode and UMI in SRR3196086_1.fastq? The length of it is 28bp, how many bp is barcode, and how many bp is UMI?

Thanks in advance for great help!

Best,

Yue

[email protected]:~/celseq2-master$ head -n 12 SRR9609653_1.fastq 
@SRR9609653.1 1 length=28
GAAGANTAGAGCTTTCTTTGTATTGGTT
+SRR9609653.1 1 length=28
AAAAA#EEEEEEAEEEEEEEEEEEEEEE
@SRR9609653.2 2 length=28
AATCANGAGGAGCAAACCGCGGTTCAGT
+SRR9609653.2 2 length=28
AAAAA#EEEEEEEEEEEEEEEEEEEEEE
@SRR9609653.3 3 length=28
GTCTTNACAAAGCTCTCCTGTTTTCTTG
+SRR9609653.3 3 length=28
/AAA6#A/EEEEEEEEA<E/EEEAAE/E

[email protected]:~/celseq2-master$ head -n 12 SRR9609653_2.fastq 
@SRR9609653.1 1 length=56
CAGAGACTTCGTTTAGCCAAAATTGTGTAGTTTGTGAAAGTGTACAAAAAATCTGN
+SRR9609653.1 1 length=56
AA//AEEEEE/EAA<EEAEE/<E</EA<A/AE<EEEA/AEEEE/6<A<///EEEE#
@SRR9609653.2 2 length=56
ATCTACGAGGCCTGCTTTCTTCTGAATGAGGATTTGGTTTTCCATCGCCTGGTTCN
+SRR9609653.2 2 length=56
AAAAAEEAEA<EAEEE/AEAEEEEEEEA/EEEE<E//EEEE6AEEA/E<E</AA<#
@SRR9609653.3 3 length=56
TATCATTACAGTTTGACTCTGTATAGTCACTACACTCGTTAGCATTGCTGAGTAAN
+SRR9609653.3 3 length=56
AAAA/A/E6E/</A///<EAAA//EE/6<EAEA/6A//EA/E</<//6/<AEEA6#

link

written
2 hours ago
by

yueli7110



Source link