Hello everybody
I have paired-end fastq files from RNA-seq which I am aligning with hisat2. Among all my 18 pairs of fastq files, I encountered an error for only one of them, which shows the message below:
Error: Read V300055969L2C002R0400381671/1 has more read characters than quality values.
libc++abi.dylib: terminating with uncaught exception of type int
(ERR): hisat2-align died with signal 6 (ABRT)
when I go looking at such V300055969L2C002R0400381671/1 read into the specific fastq file, it looks like this:
+
FFFFFFBFF>FEFFFAGFFG=GGGFDGDGGGEDFEFFFCFCGCGFFFGGFCFFGEEG2BGG<[email protected]<FGEGF
@V300055969L2C002R0400381671/1
CATGGAAAAGGTTTTCAGCCCTAGTGGGTTTTGCTGGTTGAACTGGAGGCTGCCCAGAGGAGACAGTGAGGCTCCATTTACGACTCAGCGATCCAAGAGA
+
It's the first time I encountered an error like this and I am not sure what is the cause. I also tried to re-download the file but nothing changed.
Hope some of you can explain to me what is possibly wrong. I would be very grateful!
Thanks!