gravatar for joseph.landry

3 hours ago by

Hi All,

I am going to create a custom Bowtie2 index for a sgRNA library. I have the sequences of the sgRNA "barcodes" as an excel file shown below....

>ACTL6A_1
GGATAGTTTCCAAGCTATTT

>ACTL6A_3
TTTGCTAATGGTCGTTCTAC

>ACTL6A_5
GTTGAAGGACATAGCCATCG

>ACTL6A_7
ACTGCAATTCCAGTCCACGA

This goes on for 7000 sgRNA sequences. I would like to output these as individual FASTA files. One FASTA sequence per file, with the file named after the sgRNA bar code identifier in the FASTA header. So for example file 1 would contain..

 >ACTL6A_1
GGATAGTTTCCAAGCTATTT

and be named ACTL6A_1.fa. Can someone help me figure out how to do this using terminal commands?

Any help would be greatly appreciated.

Thanks,

Joe



Source link