gravatar for osaamashehzad95

2 hours ago by

I have a sequence below about which I need the following information:

  1. Gene which it belongs to and the Number of exons and introns
  2. Translation of the sequence in all possible frames AND identify (for
    each frame) which codons are actually used in the gene it belongs to
  3. Paralogs for this gene
  4. network of the interacting proteins to the gene product

AAAGCAATAATACAATTTAAAACCTGGGTCTCTAGAGGTGTTAGGACGTG GTGTTGGGTAGGCGCAGGCAGGGGAAAAGGGAGGCGAGGATGTGTCCGAT TCTCCTGGAATCGTTGACTTGGAAAAACCAGGGCGAATCTCCGCACCCAG CCCTGACTCCCCTGCCGCGGCCGCCCTCGGGTGTCCTCGCGCCCGAGATG CGGAGGAACTGCGAGGAGCGGGGCTCTGGGCGGTTCCAGAACAGCTGCTA CCCTTGGTGGGGTGGCTCCGGGGGAGGTATCGCAGCGGGGTCTCTGGCGC AGTTGCATCTCCGTATTGAGTGCGAAGGGAGGTGCCCCTATTATTATTTG ACACCCCCCTTGTATTTATGGAGGGGTGTTAAAGCCCGCGGCTGAGCTCG CCACTCCAGCCGGCGAGAGAAAGAAGAAAAGCTGGCAAAAGGAGTGTTGG ACGGGGGCGGTACTGGGGGTGGGGACGGGGGCGGTGGAGAGGGAAGGTTG GGAGGGGCTGCGGTGCCGGCGGGGGTAGGAGAGCGGCTAGGGCGCGAGTG GGAACAGCCGCAGCGGAGGGGCCCCGGCGCGGAGCGGGGTTCACGCAGCC GCTAGCGCCCAGGCGCCTCTCGCCTTCTCCTTCAGGTGGCGCAAAACTTT GTGCCTTGGATTTTGGCAAATTGTTTTCCTCACCGCCACCTCCCGCGGCT TCTTAAGGGCGCCAGGGCCGATTTCGATTCCTCTGCCGCTGCGGGGCCGA CTCCCGGGCTTTGCGCTCCGGGCTCCCGGGGGAGCGGGGGCTCGGCGGGC ACCAAGCCGCTGGTTCACTAAGTGCGTCTCCGAGATAGCAGGGGACTGTC CAAAGGGGGTGAAAGGGTGCTCCCTTTATTCCCCCACCAAGACCACCCAG CCGCTTTAGGGGATAGCTCTGCAAGGGGAGAGGTTCGGGACTGTGGCGCG CACTGCGCGCTGCGCCAGGTTTCCGCACCAAGACCCCTTTAACTCAAGAC TGCCTCCCGCTTTGTGTGCCCCGCTCCAGCAGCCTCCCGCGACGATGCCC CTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGT GCAGCCGTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAGCAGC AGCAGAGCGAGCTGCAGCCCCCGGCGCCCAGCGAGGATATCTGGAAGAAA TTCGAGCTGCTGCCCACCCCGCCCCTGTCCCCTAGCCGCCGCTCCGGGCT CTGCTCGCCCTCCTACGTTGCGGTCACACCCTTCTCCCTTCGGGGAGACA

Where should I look for all 4 pieces of information easily? Please guide.



Source link