Fasta header contain multiple string

I have large fasta file. As you see below there are > sign present in some fasta header like

>exon2_ENST00000218032|>exon2_ENST00000218032
>exon17_ENST00000253024|>exon17_ENST00000253024

I want to remove the >sign from the header sequence, after remove the header is then look like this

>exon2_ENST00000218032|exon2_ENST00000218032
>exon17_ENST00000253024|exon17_ENST00000253024

It is an actual fasta header that has only one > sign not more than 1.

>exon2_ENST00000218032|>exon2_ENST00000218032
GAAGCTTTTGGTCTATATTGTTAATTGCCATTGCTGTAAATCTTAAAATGAATGAATAAAAATGTTTCATTTTACAAAAAACATGTTCCTTCAGTCGTCAATGCTGACCTGCATTTTCCTGCTAATATCTGGTTCCTGTGAGTTATGCGC
>exon1_ENST00000218032|>exon1_ENST00000218032
GCTGCTGCAAGTTACGGAATGAAAAATTAGAACAACAGAAACATGGTTTCTCTTCTCGGCCACCTCCTGCATAGAGGGTACCATTCTGC
>exon1_ENST00000218032|exon2_ENST00000218032
AAGCTTTTGGTCTATATTGTTAATTGCCATTGCTGTAAATCTTAAAATGAATGAATAAAAATGTTTCATTTTACAAGTTTCTCTTCTCGGCCACCTCCTGCATAGAGGGTACCATTCTGCGCTGCTGCAAGTTACGGAATGAAAAATTAG
>exon17_ENST00000253024|>exon17_ENST00000253024
TCCCTGGTGGCCCCATCCCCCAGTTCCTCACGATATGGTTTTTACTTCTGTGGATTTAATAAAAACTTCACCAGTTACAAGGCAGACGTGCAGTCCATCATCGGCCTGCAGCGCTTCTTCGAGACGCGCATGAACGAGGCCTTCGGTGAC
>exon16_ENST00000253024|>exon16_ENST00000253024
TACAGCTCCCCACAGGAGTTTGCCCAGGATGTGGGCCGCATGTTCAAGCAATTCAACAAGTTAACTGAGACCAGCCCGGTGGCACCCTGGATCTGACCCTGATCCGTGCCCGCCTCCAGGAGAAGTTGTCACCTCCC

So please can anyone tell me how I remove the multiple > sign in my fasta header.
Thanks in advance


fasta

• 124 views



Source link