gravatar for ovariohisterectomia

2 hours ago by

Hi! im generating a .fa file with the sequences of a list of genes that i got from a RNA-seq analysis. I did it with this

library(fastaR)

genelist <- scan("genelist.txt",  what="character", sep=NULL)

fa_some_records(gene_list=genelist, fasta_file="genoma.fna", outfile="sc_myGenelist.fa")

The bad news are that after that, the file sc_myGenelist.fa is empty (if i open with gedit) and the weight its 0kb)

i think the problem is because in genelist.txt the format is for example EGR_09983 and in the genoma.fna file, the format is like this NW_020171337.1

Is that a problem?

Thank you all!

there are the first lines of the files:

genelist.txt

EGR_01804
EGR_05374
EGR_07251
EGR_10508
EGR_07266
EGR_05599
EGR_01271
EGR_11080
EGR_10767
EGR_03982

genoma.fna

>NW_020171337.1 Echinococcus granulosus chromosome Unknown EG_S00967, whole genome shotgun sequence
AAATCAAATGACTGGCAAGACTACATCACTGCTGAAGTTGCTGCATCTAGTGTGagctaaaaggcaaaaattggaaagTA
CGCATTTCTGACAGGGTCATCTATTTGCTATCCTTTAGTAGGGAACATGCACACAGGTTTTAATTGCTTTAGGGAAAATG
GTTAGATTTAGTACAGTTTCACAAAATCCACATCTCCAATAATTCATCGGTTTCCTAATGAAATTGTACCTGATGCGTAG
ATTGTAATGGTCAAAGTTTATGGGATCCTGAGTGCTACAAGTGCACCAGAAcaaaattaaaggcaaaagcaaaatgcGCT
TTATTGACTGTCAACACATGGCAATACTGTGCTGGTGTGCACCCGAATTAGGGCTTCTAGTAATACGATTGTGGGGTTCT
CTGTTACCtccaaattcaacaaaatcatTACTGGCTGCCGTTCAGTATATTAAAAGTGGACACCATTCTACattggattt
tacaaaatataaatcTATTTTATCATAATTAACGataaaaggttttatttttattccattgtTTGGTATTTGCGTCATAG
CTTGCGTTAAAGTGCAGTAGTTCAAACCAAAGTAAACATTAATACCAAATGTAGAGGGCGATATCTGACGTTCTTCcttg
attattttctttttttaaaagaaaaaccatATTGTTAGGGAGTATAAGTCTCCCATGGCAGCAAAAAAAGTGTGTCGAAC
TTGAAACTGTGCAAATGAAGagagtttgcaaaaatacacCAAGCTAAGTGTGTTTCAAGGGGGGATTAAAGATGTGGAAA
GTGTGCTTAAGTTGTGATAAATCACGTTTGCGATATTAGCGCCACAAACTCCTTTATCAAAGTGCCTCTCATCGACAATC
AAAAGTGTTCGATTTAGTTCTAAACCTTTGAAGGTCCATCGCCCGCCCATCCACCAATTTACCCACACATTCACCTCGAT
CATCTCGCTTTCTTTACTAATATTGATAAAGAGATTCCTCTAA



Source link