Hi all,

I am trying to demultiplex an Illumina run in which I have introduced barcode sequences in a custom configuration:

R1 - 6 bp (barcode 1) + 144 bp
R2 - 6 bp (barcode 2) + 144 BP

index read - i7 (8 bp)

I have used bcl2fastq to introduce the sequences of each barcode (barcode1+barcode2+i7) in the header of the read.

Bcl2fastq options:

Read1StartFromCycle,7,,,,,,
Read2StartFromCycle,7,,,,,,
Read1UMILength,6,,,,,,
Read2UMILength,6,,,,,,
Read1UMIStartFromCycle,1,,,,,,
Read2UMIStartFromCycle,1,,,,,,

Fastq line example:

@M01913:344:000000000-CGVBP:1:1101:17206:1578:**AACGGT**+**TCCTTA** 1:N:0:**CTAAGTCATG**

CTTAACCCCTCCTCCCAGAGACCCCAGTTGCAAACCAGACCTCAGGCGGCTCATAGGGCACCACCACACTATGTCGAAAAGCGTTTCTGTCATCCAAATACTCCACACGCAAATTTCCTTCCACTCGGATAAGATGCTGAGGAGG

+

CCFFFFGGGGGGGGGGHHGHGHGHGGGHHHHHHHHGHHHGHHHGHHHGGGGGHHHHHHHGGGHHGHHHGHHHHHHHHGGGHHGGGGHHHHHHHHHHHHHHHHHHHHHGGGGGGHHHHHHHHHHHHHGGGGGGHHHHHHHFHGFFG

However, I can't find any suitable tool to further demultiplex these reads into individual fastq files corresponding to each unique barcode combination. Ideally, I would provide a sample sheet containing a sampleID and unique barcode combination (barcode1+barcode2+i7), and get individual fastq files named with the sampleID provided.

Any help/comments would be highly appreciated!



Source link