gravatar for harry

3 hours ago by

Hi everyone,
I want to make a virtual library fasta file for all the possible exons in a gene and also all possible exon-intron fasta file.
Example;--
I have gene SDF4 which contain 7 exons:

ENSE00003851528:
GCGACCGCTTCCGCCCGGAGGAGAGATGGTGGCGCCGGCGTCCCCTCCGTGAGGTCGCGC
CCGTTCGCACCGCCCCCGCCCGCAAGAAAGATGGCAGTGGCCTGATCCGGGCCCGTTGGC
GGCGTCACTGACGCTTCGCTCCGGTCCTCGGATCCCGAGCGCGGGGAGGCAGACCG

ENSE00003459646:
ACTGTGAGCTGCTTGTCCCCATCCTGCGGCCGTCCTGGGGACACAGAGCCCTCCGTGGTG
CCCGGGGATTGGATTGGAGCCAGGACCTCACTTCCTCCTCTGCCCCTGCCCCTGCCCCTC
CCAGCACCTGGCCCACACCCTGCAGCCCGCCCCATGGTCTGGCCCTGGGTGGCGATGGCG
TCCAGGTGGGGTCCCCTCATTGGCCTGGCTCCGTGCTGCCTCTGGCTCCTGGGGGCAGTC
CTTCTGATGGACGCGTCTGCACGGCCTGCCAACCACTCGTCCACTCGAGAGAGAGTAGCC
AACAGGGAGGAGAATGAGATCCTGCCCCCAGACCACCTGAACGGGGTGAAGCTGGAGATG
GACGGGCACCTCAATCGCGGCTTCCACCAGGAGGTCTTCCTAGGCAAGGACCTGGGTGGC
TTTGATGAGGACGCGGAGCCGCGGCGGAGCCGGAGGAAGCTGATGGTCATCTTTTCCAA

ENSE00000869640:
GGTGGATGTGAACACTGACCGGAAGATCAGTGCCAAGGAGATGCAGCGCTGGATCATGGA
GAAGACGGCCGAGCACTTCCAGGAGGCCATGGAGGAGAGCAAGACACACTTCCGCGCCGT
GGACCCTGACGGGGACG

So i want to create all possible like-----:--
ENSE00003851528+ENSE00003459646
GCGACCGCTTCCGCCCGGAGGAGAGATGGTGGCGCCGGCGTCCCCTCCGTGAGGTCGCGC
CCGTTCGCACCGCCCCCGCCCGCAAGAAAGATGGCAGTGGCCTGATCCGGGCCCGTTGGC
GGCGTCACTGACGCTTCGCTCCGGTCCTCGGATCCCGAGCGCGGGGAGGCAGACCGACTGTGAGCTGCTTGTCCCCATCCTGCGGCCGTCCTGGGGACACAGAGCCCTCCGTGGTG
CCCGGGGATTGGATTGGAGCCAGGACCTCACTTCCTCCTCTGCCCCTGCCCCTGCCCCTC
CCAGCACCTGGCCCACACCCTGCAGCCCGCCCCATGGTCTGGCCCTGGGTGGCGATGGCG
TCCAGGTGGGGTCCCCTCATTGGCCTGGCTCCGTGCTGCCTCTGGCTCCTGGGGGCAGTC
CTTCTGATGGACGCGTCTGCACGGCCTGCCAACCACTCGTCCACTCGAGAGAGAGTAGCC
AACAGGGAGGAGAATGAGATCCTGCCCCCAGACCACCTGAACGGGGTGAAGCTGGAGATG
GACGGGCACCTCAATCGCGGCTTCCACCAGGAGGTCTTCCTAGGCAAGGACCTGGGTGGC
TTTGATGAGGACGCGGAGCCGCGGCGGAGCCGGAGGAAGCTGATGGTCATCTTTTCCAA

ENSE00003851528+ENSE00000869640
GCGACCGCTTCCGCCCGGAGGAGAGATGGTGGCGCCGGCGTCCCCTCCGTGAGGTCGCGC
CCGTTCGCACCGCCCCCGCCCGCAAGAAAGATGGCAGTGGCCTGATCCGGGCCCGTTGGC
GGCGTCACTGACGCTTCGCTCCGGTCCTCGGATCCCGAGCGCGGGGAGGCAGACCGGGTGGATGTGAACACTGACCGGAAGATCAGTGCCAAGGAGATGCAGCGCTGGATCATGGAGAAGACGGCCGAGCACTTCCAGGAGGCCATGGAGGAGAGCAAGACACACTTCCGCGCCGTGGACCCTGACGGGGACG

Like this, I want to make an all possible library preparation. So anyone can help me how do I download all Exons of genes and create a virtual RNA sequence with all possible exons of genes.
Thanks in advance.

link

written
3 hours ago
by

harry10



Source link