I have an issue with some mapped sequencing with 9-base UMIs (the UMI is at the end of the read ID). A lot of the time, the individual molecules are (consensus) deduplicated correctly, but where there are very slight location differences between two or more sequences of the same molecule, such as a slightly shorter read,

NB500905:50:HVY23AFXY:2:21206:18601:14328:AAAAAAAAA 145 chr4    76426799    60  57M =   76426801    68  CCTCAGTTTCCCGAGTAGCTGGGACTACAGGTGCCCGCCACCATGCCCGGCTAATTT   AE/EAE/E/EEEE/EA/EE/EEEAE/EEAAE/EEEEE/E//EE/EAEEAEEEEEEEE   AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:57 YS:i:0  YT:Z:DP RG:Z:10-B   NH:i:1  
NB500905:50:HVY23AFXY:4:21412:17448:14097:AAAAAAAAA 145 chr4    76426799    60  58M =   76426801    0   CCTCAGTTTCCCGAGTAGCTGGGACTACAGGTGCCCGCCACCATGCCCGGCTAATTTT  6E/////A/6EE//////A//E////A///E//EEE/EE//E//6EEE/E//AEEEEE  AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:58 YT:Z:UP RG:Z:10-B   NH:i:1  

the molecule is being retained, duplicated in the deduplicated BAM files. So my first question is this, is there an algorithm to correctly deduplicate this molecule and return one consensus sequence rather than two?

Secondly, it appears that other sequencing issues with the first read in a pair has resulted in the first read being different, with the second being the same, such as in this example (12 pairs of what is presumably the same molecule - the 9-bp UMI and the locations of the second read are very similar):

NB500905:50:HVY23AFXY:1:11210:13179:6528:AAAAAAAAA  163 chr17   39699473    60  60M =   39699492    86  AAGTCCTTTCGATGTGACTGTCTCCTCCCAAATTTGTAGACCCTCTTAAGATCATGCTTT    E66/A/EE6//6E6E/A/EA///E//EE/EEAEEE/E///EA///EEEE/E//<A</EEE    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:60 YS:i:0  YT:Z:CP RG:Z:10-B   NH:i:1  
NB500905:50:HVY23AFXY:2:11111:19485:18118:AAAAAAAAA 163 chr17   39699474    60  60M =   39699525    120 AGTCCTTTCGATGTGACTGTCTCCTCCCAAATTTGTAGACCCTCTTAAGATCATGCTTTT    EE/EAEEEEEEEEAE6/EE/E/EE/EEEEEEEEEEEEEAEEE/EEEEEEEEEAAE/EEEE    AS:i:-3 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:0  MD:Z:38A21  YS:i:0  YT:Z:CP RG:Z:10-B   NH:i:1  
NB500905:50:HVY23AFXY:2:21308:6819:11408:AAAAAAAAA  163 chr17   39699477    60  58M =   39699519    109 CCTTTCGATGTGACTGTCTCCTCCCAAATTTGTAGACCCTCTTAAGATCATGCTTTTC  EA/<EAAE//EE/EE/EEEAE<EAAE/EAE</EEEEE/EEEEEEEAEE/A<<EEEAEE  AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:58 YS:i:0  YT:Z:CP RG:Z:10-B   NH:i:1  
NB500905:50:HVY23AFXY:2:21309:11545:15754:AAAAAAAAA 163 chr17   39699477    60  58M =   39699486    78  CCTTTCGATGTGACTGTCTCCTCCCAAATTTGTAGACCCTCTTAAGATCATGCTTTTC  //E/EEAEEEEE6EE/EAE////EEEE/EAEEEAEA///<E/<EE/EEEEEE/A6AA6  AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:58 YS:i:0  YT:Z:CP RG:Z:10-B   NH:i:1  
NB500905:50:HVY23AFXY:3:11406:13328:7002:AAAAAAAAA  163 chr17   39699477    60  58M =   39699533    124 CCTTTCGATGTGACTGTCTCCTCCCAAAATTGTAGACCCTCTTAAGATCATGCTTTTC  E/EE/EEEEEEEEEEEEEEEEEEEEEEE6EEEEEAEE/A6EEEEEEEEEEEEAEEAEE  AS:i:-4 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:28T29  YS:i:-5 YT:Z:CP RG:Z:10-B   NH:i:1  
NB500905:50:HVY23AFXY:4:21402:24172:19713:AAAAAAAAA 83  chr17   39699535    60  69M =   39699474    -130    AGATACTTCAAAGATTCCAGAAGATATGCCCCGGGGGTCCTGGAAGCCACAAGGTAAACACAACACATC   /EEEEEAA/AAEE/AEEEAEA//EEEE<AEEAEE</EEEEAE<E/EAEEAEE/E6E/EAEEEE/EEAAA   AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:69 YS:i:-6 YT:Z:CP RG:Z:10-B   NH:i:1  
NB500905:50:HVY23AFXY:4:21402:24172:19713:AAAAAAAAA 163 chr17   39699474    60  60M =   39699535    130 AGTCCTTTCGATGTGACTGTCTCCTCCCAAATTTGTAGACCCTCTTAAGATCATGCTTTT    E6/EAEE////EE///A///A/EE////EE/E6</<A/AE//!//<E66E/!E///6/E/    AS:i:-6 XN:i:0  XM:i:2  XO:i:0  XG:i:0  NM:i:0  MD:Z:42T8C8 YS:i:0  YT:Z:CP RG:Z:10-B   NH:i:1  

The obvious non-deduplication works to bias anything downstream, such as variant calling. This is a more difficult molecule to consensus deduplicate, but a method which would work with this case would work in the first case.

To check that this is not a mapping issue, I have blatted the two sets of sequences on the genome browser, and it is very clear that one of the two reads in each pair is effectively fixed, with the other being started at different positions on the molecule (my seuqencing collaborator suggests that the Illumina primer for read 1 did not bind effectively, and that it is 'slippy' in some sense):

BLAT of first set of non-dedup reads

BLAT of 12 pairs of non-dedup reads from same molecule

So my question is, is there a robust consensus deduplication method that can deal with both cases, and derive a single pair of consensus reads from each set?

Source link