gravatar for NickJD

2 hours ago by

Hi,

I am trying to produce a .phylip file output using the ClustalO/X systems. I have a test set of 7 viral genomes (30kb) and I have run them through both the default options of ClustalO and ClustalX.

The ClustalX software seems to produce a phylip file which works with other software such as FastTree.

However, ClustalO produces a slightly different output. The output from ClustalO does not work in FastTree and I get the following error:

No sequence in phylip line TCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCAC

As you can see from the two files, there are some minor differences which could be causing the problem.

ClustalO:

 MT084071.1--------------------------------------------------

 TCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCAC
  

ClustalX

      MT084071.1 ---------- ---------- ---------- ---------- ---------- 

      TCTTGTAGAT CTGTTCTCTA AACGAACTTT AAAATCTGTG TGGCTGTCAC
  

Is this a bug or is there a way to get ClustalO to produce 'correctly' formatted .phylip files such as ClustalX does.

Many Thanks



Source link