Biopython blastn speed versus web query

0

I wonder if anyone can help me. I'm experiencing big performance problems when running a BLAST query in biopython. I have a sequence of about 1000 nt (see below) which I am trying to run blastn.

When I run this in biopython, occasionally I get something back in about 60 seconds [usually the first time I run it], but more often than not, it just seems to run forever

result_handle = NCBIWWW.qblast("blastn","nt",frag_2)
blast_record = NCBIXML.read(result_handle)

But when I paste the same sequence into the Blastn web tool directly, I get results back in about 15 seconds each time. Am I doing something wrong?

TGACCGGCGCGTTGTTGACGGTGGTGCCGTTGGTCGAATTCAGGTCCGACAGCAGCGCGGCATGCCCGTCGAAGCGCACCTCGAGGTGGCGGCGCGAGACGCCGGTATCGGGCAGACGGAACTGCGCGTCCTGACCGCGGCCGATCACATTGGTGCCCTCACGCAACTGGTACGTGCGTCCGCTGCCGTCGTCCAGCTGCAGGGTGACGGTGGTGCGACCGGCACCGGCGCCGCCTCCAGTGGGAGCGCCGTAGTCGGGGCTGCTCTGGTAGCCGCCGTGCTCGTAGTCGCCGTACTCGGGCTCGCCGTAACCGCCCTGAGGTGATCCGTAGCCGCCCTGCTGCGGCGGGGCGCCGTAGCCACCCTGCTGCGGGTAGGCCGGGGGACGACCGTAGTCCTGGCCCGGAGGCGGACCCTGCGGTGCGCCATAGCCACCGCCCTGTTCGTACTCGCCGTAGTTGGGACGAGGAGGCTCGCCGTACCCACCCTGTTGCGGCGGGGCGCCGTAGCCGCCCTGCTGCGGAGGTGCCGGGGGACGGCCGTATTCCTGACCGCCGCCATAGCCGCCCTGCTCATAGCCACCGCGGCCGCCTTGGTCGTAGCCACCCTGCTGTGGCGGGCGCTGTTGGTAGCCGCCCTGCTCATAGCCGGCCGGTGGGCGACCGTAATCCTGCCCGTACTGCTGGCCCTGCCCATATCCGCCCTGGCGCGGGGGGTATCCCTGGTCACCCTGCGGAGGCTGCTGACCACGTGGATCCTGTTCGGGACGTCCGTAGCGGTCGTCCTCTCGGCCGTACTCTTCGCCGGGGCGTCCCTGCTGGGGACCTGGGTTGTCAGTCATGGATGCTCCTGGTTGTGGATCCGGGGTCGAAGGGGCAGTCGTCACGGCGCCGTGCGTACGGTCCCGCTTGGTGTCGGGATTGACCACACCGCGCGTGCGAAACTGGCCGGTGTGCAAGTTCGGTGATTGTTCGAATCGGACAACAACTTCACCATACGT


blast


biopython

• 91 views



Source link