gravatar for Biostar

2 hours ago by

Hello,

I have an unmasked genome and its repeat file in bed/gff format. I tried to softmask the genome using maskFastaFromBed from bedtools (v2.26), but it doesn't automatically mask the minus strand by taking strand information from the .bed file. There is no -s option to switch on strandedness either (a feature available in getfasta). So basically, the masking is always returned on the + strand and I'm surprised! Does anyone have any ideas or alternative tools to suggest? Example run and output is below.

Thanks.

genome.fasta

Chr1
ATTGACAGAAATATCATCACATCTATTCTTTCTCTCCCCTAGTTTAGCAAAT
Chr2
GACATATAAATAATAGTGGGAAAGAGACCGGATGAAACCTCAACTGTGGCTTTCATTAACAGATCA

genome.bed

Chr1 0 17 for 1 +
Chr2 0 17 rev 1 -

maskFastaFromBed -soft -fi genome.fasta -bed genome.bed -fo genome_softmasked.fasta

Output:

Chr1
attgacagaaatatcatCACATCTATTCTTTCTCTCCCCTAGTTTAGCAAAT
Chr2
gacatataaataatagtGGGAAAGAGACCGGATGAAACCTCAACTGTGGCTTTCATTAACAGATCA

link

modified 2 hours ago

by

genomax77k

written
2 hours ago
by

Biostar0



Source link