gravatar for ericjkort

2 hours ago by

I am aligning some FASTQs with STAR using a custom index I created to add a few exogenous constructs to the human genome. One of these constructs is eGFP. In the Aligned.out.sam file generated by STAR, I see many alignments like this:

A00661:41:HYKT7DRXX:1:1205:19696:22733  83  eGFP    494 255 50M =   400 -144    ACTTTAAGATCCGACACAATATTGCGGACGGTTCGGTGCAGCTTGCGGAC  FFFFFFFF:FFFFFF::FFF:F:F,FFFFFFFFFFFFFFFFFFFFF:F,F  NH:i:1  HI:i:1  AS:i:95 nM:i:1

However, the count for eGFP in ReadsPerGene.out.tab is zero:

ENSG00000268674 0   0   0
eGFP    0   0   0

The corresponding entry in my customized GTF is:

eGFP     ensembl exon    0       717    .       +       .       gene_id "eGFP"; transcript_id "eGFP"; exon_number "1"; gene_name "eGFP"; transcript_name "eGFP";

Other genes and constructs seem to be counted fine. Can anyone spot what the problem is or give some direction as to how to investigate further?

-Eric



Source link