align interleaved fastq file

Hi,

I have interleaved fastq files from RNAseq paired end reads, after extracting a transposable element from reads. It looks like this:

@V300012057L3C001R0011341817/1
CTTTACACTCTTTCCCTACACGACGCTCTTCCACGCTCTTCCGATCTTCGGGGGGTGTTCTTCTCGGGCATGCTAGTTGTGGTTTGTCCAAACTCATCGA
+
FFCD>[email protected]?FFFFDFFEFFFFF=C2CBFFF7FF3<FCAFE=>F>FF>FEDFCBFFFDFFFF9FFCD:F<>FFCFFFE<FECD
@V300012057L3C001R0011341817/2
GTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGGCCCCCATCGCCTTCGCCAGATCT
+
D&;=FDDEC8,9A/EBC5?B:[email protected]?>EEF/<[email protected]<[email protected]@[email protected]<CDE?E:6E;[email protected]?BECE;EB9'6F<@CA)[email protected]@CE9FBA<B
@V300012057L3C001R037112077/1
CGATCACGCTCTTCCGATCTGTGCATTTGTGTGCCGGTTACCATGCTAGTTGTGGTTTGTCCAAACTCATCGAGCTCGAGATCTGGCGAAGGCGATGGGG
+
@A:FFFDCEFEFEBEF5F1FF:BFF>[email protected]@BFDE>[email protected]@[email protected]:[email protected];DDF=F:??:?E8F>EBC?
@V300012057L3C001R037112077/2
CCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCCATCGCCTTCGCCAG
+
[email protected]@FFCFF?FFF;FFFFFFFFFCFFFCFFEFF:[email protected]>[email protected]
@V300012057L3C001R037167604/1
TAAATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTATAGGGATCAGATCGGAAGAGCGT
+
AGFFFGFFFFFFFFFFFFFFFGFFFFFFFFGGFGGFFGGFFFDFFFFFFFFFFEFGFGFFFGFGFAFGFFFFFFFFFGFFFFFGGFF>FFFFFFFFFFFF
@V300012057L3C001R037167604/2
GTCGGAAGTTTACATACACCTTAGTATTTGGTAGCATTGCCTTTACACTCTTTCCCTACACGACGCTCTTCCGATCTGATCCCTATACAGTTGAAGTCGG

Is their any nice way to align this to the human genome ?
Thanks in advance.


interleaved


fastq


align

• 29 views



Source link